View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_low_23 (Length: 253)
Name: NF1419_low_23
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 244
Target Start/End: Complemental strand, 30726510 - 30726287
Alignment:
| Q |
21 |
ctgcttttattgttttccgaattagctcctcaactcaattttttattatccatttatcaattttgtaaattggttattgcatttaacattgaaaaaactc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30726510 |
ctgcttttattgttttccgaattagctcctcaactcaattttttattttgtatttatcaattttgtaaattggttattgcatttaacattgaaaaaactc |
30726411 |
T |
|
| Q |
121 |
ctctnnnnnnncattgagaaaattttgtaggtcgaacttatcaattttctaaattgtctttaaaacttatctaccatagtttcaaacttttcttttataa |
220 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30726410 |
cactaaaaaaacattgagaaaattttgtaggtcgaacttatcaattttctaaattgtctttaaaacttatctaccatagtttcaaacttttcttttataa |
30726311 |
T |
|
| Q |
221 |
gcaagatatattgaactaaagaga |
244 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
30726310 |
gcaagatatattgaacaaaagaga |
30726287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University