View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_low_25 (Length: 251)
Name: NF1419_low_25
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 14 - 233
Target Start/End: Complemental strand, 29093351 - 29093122
Alignment:
| Q |
14 |
agaggatggaaaggacgatagttggctcctatatccgtttttgaaa---tatgcacaactaaaatcgtgaccattgatcaaaatataacagatatctttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29093351 |
agaggatggaaaggacgatagttggctcctatatccgtttttgaaaccatatgcacaactaaaatcgtgaccattgatcaaaatataacagatatctttg |
29093252 |
T |
|
| Q |
111 |
ttttttgtggcgatggcttgcagaactgaactcatttgatggaaacc----cac--ct-ttattattaagtcattgttttgtgcattgcagctggttaca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29093251 |
ttttttgtggcgatggcttgcagaactgaactcatttgatggaaaccatatcactactcttattattaagtcattattttgtgcattgcagctggttaca |
29093152 |
T |
|
| Q |
204 |
tcaccgtgatctcataacacatagtgaact |
233 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |
|
|
| T |
29093151 |
tcaccgtgatctcataacacgtagtgaact |
29093122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University