View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1419_low_31 (Length: 238)

Name: NF1419_low_31
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1419_low_31
NF1419_low_31
[»] chr3 (1 HSPs)
chr3 (106-238)||(20365525-20365657)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 106 - 238
Target Start/End: Complemental strand, 20365657 - 20365525
Alignment:
106 gattcagatcatttgttgaaaatgttggtgtttggttcactttcattattttgcctctaaaccttcaatttcatccttaaactatcattagtttagttat 205  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||    
20365657 gattcggatcatttgttgaaaatgttggtgtttggttcactttcattattttgcctctaaaccttcaatttcgtccttaaactattattagtttagttat 20365558  T
206 gaattaaggagagtggtaatttagaagctaact 238  Q
    |||||||||||||||||||||||||||||||||    
20365557 gaattaaggagagtggtaatttagaagctaact 20365525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University