View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_low_33 (Length: 228)
Name: NF1419_low_33
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_low_33 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 88 - 228
Target Start/End: Original strand, 29165996 - 29166135
Alignment:
| Q |
88 |
cccattttggtttatatgatatctctttcaaaaaagccgtatttagatagttgatgataagagtaaccnnnnnnngtcaatagtggttataatgttgaaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29165996 |
cccattttggtttatatgatatctctttcaaaaaagccgtatttagatagttgatgataagagtaacc-ttttttgtcaatagtggttataatgttgaaa |
29166094 |
T |
|
| Q |
188 |
acgctgtgtttcatcatctatacatgaacatgaaccaaaaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29166095 |
acgctgtgtttcatcatctatacatgaacatgaaccaaaaa |
29166135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 29165909 - 29165954
Alignment:
| Q |
1 |
aaattaatttttgattcctctaaaagatagatataactcattacca |
46 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
29165909 |
aaattaattttggattcttctaaaagatagatataactcattacca |
29165954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University