View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1419_low_9 (Length: 319)
Name: NF1419_low_9
Description: NF1419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1419_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 51049523 - 51049222
Alignment:
| Q |
18 |
tgattggatactataatactttgaaatgattaatgtgaccctaaaagtagctttaattttttatttaatatcagtaacctgggcaactgcaagaatgata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51049523 |
tgattggatactataatactttgaaatgattaatgtgaccctaaaagtagctttaattttttatttaatatcagtaacctgggcaactgcaagaataata |
51049424 |
T |
 |
| Q |
118 |
atctattttgttcctttaatccctcaaacttttatattaagaaatatacttcactaattttcatttactaacattagctatctttaaatttgtagaaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51049423 |
atctattttgttcctttaatccctcaaacttttatattaagaaatatacttcactaattttcatttactaacattagctatctttaaatttgtagaaaca |
51049324 |
T |
 |
| Q |
218 |
atgcactcttcatcagtgaagaaagatgtgagtatcgagaaaacacctaaaaataatggtgatagtggtgctgaaactaaggggattcttctcaacaact |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51049323 |
atgcactcttcatcagtgaagaaagatgttagtatcgagaaaacacctaaaaacaatggtgatagtggtgctgaaactaaggggattcttctcaacaact |
51049224 |
T |
 |
| Q |
318 |
gc |
319 |
Q |
| |
|
|| |
|
|
| T |
51049223 |
gc |
51049222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University