View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_high_17 (Length: 445)
Name: NF14200_high_17
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 15 - 350
Target Start/End: Original strand, 40143065 - 40143397
Alignment:
| Q |
15 |
cataggcagaagatgggtagatgaaatctcatcattggaagaaaagtgggcagcaatagtatcaattctgcgtttcacgaactcattctccatttctaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
40143065 |
cataggcagaagatgggtagatgaaatatcttcattggaagcaaagtgggcagcaatagtatcaagtctgcgtttcacgaactcattctccatttctagt |
40143164 |
T |
 |
| Q |
115 |
taacgtggttctcaaagacttcacataataaatggataatgcagaatgtggcacatatatggaggggaagtgaattgtgtgaataggagatatttttatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40143165 |
taacgtggttctcaaagacttcacataataaatggataatgcagaatgtggcacatatatggaggggaagtgaattgtgtgaataggagatatttttatg |
40143264 |
T |
 |
| Q |
215 |
ac-nnnnnnnntcgtaagtgggacctaatcgatgtaaatagtatgtccggaaagagacaaagatagatttcacaaggactatgctagctagctaggaaca |
313 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
40143265 |
acaaaaaaaaatcgtaagtgggacctaatcgatgtaaatagtatgtccggaaagagacaaagatagatttcacaaggactgt----gctagctaggaaca |
40143360 |
T |
 |
| Q |
314 |
aaacatatcagtttccgttggcaatttaaactcttca |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40143361 |
aaacatatcagtttccgttggcaatttaaactcttca |
40143397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 379 - 426
Target Start/End: Original strand, 40143421 - 40143468
Alignment:
| Q |
379 |
gtggaatatgattttcatttagattatcaatgcacttcaattcatatc |
426 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40143421 |
gtggaatatgattttcatttatattatcaatgcacttcaattcatatc |
40143468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 74 - 110
Target Start/End: Complemental strand, 28174715 - 28174679
Alignment:
| Q |
74 |
tatcaattctgcgtttcacgaactcattctccatttc |
110 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
28174715 |
tatcaattctgcgtttcaccaactaattctccatttc |
28174679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University