View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_high_23 (Length: 369)
Name: NF14200_high_23
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_high_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 11 - 350
Target Start/End: Original strand, 10812031 - 10812370
Alignment:
| Q |
11 |
cagagaaatatggttctgccattggtgcatcaattcccatcatccttgattcactagcaacatctccaaggaaaccattgtaaaatgctttaaccttaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10812031 |
cagagaaatatggttctgccattggtgcatcaattcccatcatccttgattcactagcaacatctccaaggaaaccattgtaaaattctttaaccttaat |
10812130 |
T |
 |
| Q |
111 |
tactatgtaaagaaaagatgttgcaatgtaagagaatcccaacctgtgaagcttttgtgcttgagctagatttgtgctatgttttgtacccttttcaagc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10812131 |
tactatgtaaagaaaagatgttgcaatgtaagagaatcccaacctgtgaagcttttgtgcttgagctagatttgtgctacgttttgtacccttttcaagc |
10812230 |
T |
 |
| Q |
211 |
gatgatcccttgtttttgtgttctttgaagttgctttcttcagggtagatgatgctattcttctctattcgacggtaaccatagcttttgcgacgagatg |
310 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10812231 |
gatgatcccttatttttgtgttctttgaagttgctttcttcagggtagatgatgctattcttctctattcgacggtaaccatagcttttgcgacgagatg |
10812330 |
T |
 |
| Q |
311 |
gtgttggtttgcttcctctttcaccataagaggctgcaca |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10812331 |
gtgttggtttgcttcctctttcaccataagaggctgcaca |
10812370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University