View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_high_38 (Length: 276)
Name: NF14200_high_38
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 266
Target Start/End: Original strand, 7340875 - 7341123
Alignment:
| Q |
18 |
ctagcaaatttccttaatttttcaatttcatcttcagtgccaccaccaactattgctcccataacaaccgcggcttctaataaagccgcggttttacgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340875 |
ctagcaaatttccttaatttttcaatttcatcttcagtgccaccaccaactattgctcccataacaaccgcggcttctaataaagccgcggttttacgaa |
7340974 |
T |
 |
| Q |
118 |
gatgaataaactctagtgtctctaattccacgtttgattttccttctgattccaaatcaacaatttgtccagcaactagtccttcttttccaacagcttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340975 |
gatgaataaactctagtgtctctaatcccacgtttgattttccttctgattccaaatcaacaatttgtccagcaactagtccttcttttccaacagcttt |
7341074 |
T |
 |
| Q |
218 |
tgccagctcagcaattgctctaacaattctttcaggtgggacccctatg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7341075 |
tgccagctcagcaattgctctaacaattctttcaggtgggacccctatg |
7341123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University