View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_high_39 (Length: 262)
Name: NF14200_high_39
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_high_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 19 - 95
Target Start/End: Original strand, 18695446 - 18695522
Alignment:
| Q |
19 |
acaccctttgggaaaattcccattggaagaccatggttgaatagaacctcgtagatggatgttgcattggaacttgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18695446 |
acaccctttgggaaaattcccattggaagaccatggttgaatagaacctcgtagatggatgttgcattggaacttgt |
18695522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University