View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_high_44 (Length: 251)
Name: NF14200_high_44
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_high_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 8404333 - 8404102
Alignment:
| Q |
18 |
aggaacgctacaaaactctttaaacaacttcgtaggcaaatccaaaccaaactatcacttggtaataataatcacagtgaagatgatgtgagggatgcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404333 |
aggaacgctacaaaactctttaaacaacttcgtagacaaatccaaaccaaactatcacttggtaataataatcacagtgaagatgatgtgagggatgcaa |
8404234 |
T |
|
| Q |
118 |
ttgagaaggttttggctcttgataaagcctatccacttcctttgttaggaggtgcaatgattgcgaaatttccttccaaatttgaagcatctaggtggtg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
8404233 |
ttgagaaggttttggctcttgataaagcctatccacttcctttattaggaggtgcaatgattgagaaatttccatccaaatttgaagcatctatgtggtg |
8404134 |
T |
|
| Q |
218 |
gccatgtccaaagaaaattactggattgaaca |
249 |
Q |
| |
|
|||||||| ||||||||| ||| ||| ||||| |
|
|
| T |
8404133 |
gccatgtcaaaagaaaatgactagatagaaca |
8404102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University