View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_high_47 (Length: 224)
Name: NF14200_high_47
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 43159645 - 43159442
Alignment:
| Q |
1 |
tttctagaaatagaagtctgacttagtagactgctttggagtgtcggcttgtgattcggtgcggaaggaagaactagggatgatgattggattgtaattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43159645 |
tttctagaaatagaagtctgacttagtaaactgctttggagtgtcggcttgtgattcggtgcggaaggaagaactagggatgatgattggattgtaattg |
43159546 |
T |
|
| Q |
101 |
gttactacaaaatacgtaaaaagagaggtttaatttccatnnnnnnnnnnnnnnnnntgtttggtaccagcactacaagtctgcaattgtcacatagagt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43159545 |
gtttctacaaaatacgtaaaaagagaggtttaatttccataaaaataaaataaaaaatgtttggtaccagctctacaagtctgcaattgtcacatagagt |
43159446 |
T |
|
| Q |
201 |
aata |
204 |
Q |
| |
|
|||| |
|
|
| T |
43159445 |
aata |
43159442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University