View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_low_27 (Length: 353)
Name: NF14200_low_27
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 13)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 14 - 343
Target Start/End: Complemental strand, 8404123 - 8403797
Alignment:
| Q |
14 |
aagaatattactggattgaacaataagatggagattaataatgagagcaataatgggtggaatttggaattggaagatgaaatgaatgaggtaattgaag |
113 |
Q |
| |
|
||||| || ||| ||| ||||| |||||||||||||||| ||| | |||||||| ||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
8404123 |
aagaaaatgactagatagaacagtaagatggagattaat---gaggggaataatggatggaatttggagttggaaaatgaaatgaaggaggtaattgaag |
8404027 |
T |
 |
| Q |
114 |
tggtgaagagaaaagatattgaggattatgagagattagggaatattgcatcaaagattaacaagggtttagcaatttttggacctttgttaacaggaat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
8404026 |
tggtgaagagaaaagatattgaggattatgagagattagggaatattgcattaaagattaacaagagtttagcaattttaggacctttgttaacaggaat |
8403927 |
T |
 |
| Q |
214 |
tgcagctataggatcatcatttgtaggtgatgaaatgttggtaaattttgttcctgctttttccggtgctttggcaactgttgttaatacttttgagcat |
313 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8403926 |
tgcagctatagggtcatcatttgtaggtgatgaaatgttggtaaattttgttcctgctttttccggtgctttggcaactgttgttaatacttttgagcat |
8403827 |
T |
 |
| Q |
314 |
ggaggacaagttggtatggtgtttgtgatg |
343 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
8403826 |
ggaggacaagttggtatggtgtttgagatg |
8403797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 333
Target Start/End: Complemental strand, 8368183 - 8368134
Alignment:
| Q |
284 |
ttggcaactgttgttaatacttttgagcatggaggacaagttggtatggt |
333 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
8368183 |
ttggctactgctgttaattcttttgagcatggtggacaagttggtatggt |
8368134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 333
Target Start/End: Original strand, 8401227 - 8401276
Alignment:
| Q |
284 |
ttggcaactgttgttaatacttttgagcatggaggacaagttggtatggt |
333 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
8401227 |
ttggctactgctgttaattcttttgagcatggtggacaagttggtatggt |
8401276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 333
Target Start/End: Original strand, 8422804 - 8422853
Alignment:
| Q |
284 |
ttggcaactgttgttaatacttttgagcatggaggacaagttggtatggt |
333 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
8422804 |
ttggctactgctgttaattcttttgagcatggtggacaagttggtatggt |
8422853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 8459649 - 8459706
Alignment:
| Q |
281 |
gctttggcaactgttgttaatacttttgagcatggaggacaagttggtatggtgtttg |
338 |
Q |
| |
|
|||||||||||||||||||| || || || |||||||| |||||||||||||| |||| |
|
|
| T |
8459649 |
gctttggcaactgttgttaacacattagaacatggagggcaagttggtatggtttttg |
8459706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 8411921 - 8411878
Alignment:
| Q |
295 |
tgttaatacttttgagcatggaggacaagttggtatggtgtttg |
338 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
8411921 |
tgttaatacttttgagcatggtggacaagttggcatggtttttg |
8411878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 8434019 - 8433976
Alignment:
| Q |
295 |
tgttaatacttttgagcatggaggacaagttggtatggtgtttg |
338 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
8434019 |
tgttaatacttttgagcatggtggacaagttggcatggtttttg |
8433976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 296 - 338
Target Start/End: Complemental strand, 8417001 - 8416959
Alignment:
| Q |
296 |
gttaatacttttgagcatggaggacaagttggtatggtgtttg |
338 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
8417001 |
gttaatacttttgagcatggtggacaagttggcatggtttttg |
8416959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 297 - 338
Target Start/End: Original strand, 8376087 - 8376128
Alignment:
| Q |
297 |
ttaatacttttgagcatggaggacaagttggtatggtgtttg |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
8376087 |
ttaatacttttgagcatggtggacaagttggcatggtttttg |
8376128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 297 - 338
Target Start/End: Complemental strand, 8431070 - 8431029
Alignment:
| Q |
297 |
ttaatacttttgagcatggaggacaagttggtatggtgtttg |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
8431070 |
ttaatacttttgagcatggtggacaagttggcatggtttttg |
8431029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 117 - 153
Target Start/End: Complemental strand, 8368350 - 8368314
Alignment:
| Q |
117 |
tgaagagaaaagatattgaggattatgagagattagg |
153 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8368350 |
tgaagagaaaagatatggaagattatgagagattagg |
8368314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 8401060 - 8401096
Alignment:
| Q |
117 |
tgaagagaaaagatattgaggattatgagagattagg |
153 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8401060 |
tgaagagaaaagatatggaagattatgagagattagg |
8401096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 8422637 - 8422673
Alignment:
| Q |
117 |
tgaagagaaaagatattgaggattatgagagattagg |
153 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8422637 |
tgaagagaaaagatatggaagattatgagagattagg |
8422673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 304 - 338
Target Start/End: Complemental strand, 55336151 - 55336117
Alignment:
| Q |
304 |
ttttgagcatggaggacaagttggtatggtgtttg |
338 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
55336151 |
ttttgagcatggtggacaagttggtatggtgtttg |
55336117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University