View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_low_44 (Length: 254)
Name: NF14200_low_44
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 53492331 - 53492109
Alignment:
| Q |
20 |
ataacaatgtgttggctgctgtaacgtaatgaaaactttcaagctttatataagaggcttaaacaattccaaaaattgatattatgcattgtagttatat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53492331 |
ataacaatgtgttggctgctgtaacgtaatgaaaactttcaagctttatataagaggcttaaacaattccaaaaattgatattatgcattgtagttatat |
53492232 |
T |
|
| Q |
120 |
gtcttacataatgccttaaaattctgcccattttctttttgaatggattttcatcttacggtgagttttctttttgaatgggtgttcaccttgtttgggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53492231 |
gtcttacataatgccttaaaattctgcccattttctttttgaatggattttcatcttacggtgagttttctttttgaatgggtgttcaccttgtttgggt |
53492132 |
T |
|
| Q |
220 |
ttggtgaattagtcttggatatt |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
53492131 |
ttggtgaattagtcttggatatt |
53492109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 78 - 167
Target Start/End: Complemental strand, 53500207 - 53500118
Alignment:
| Q |
78 |
ttaaacaattccaaaaattgatattatgcattgtagttatatgtcttacataatgccttaaaattctgcccattttctttttgaatggat |
167 |
Q |
| |
|
||||| ||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
53500207 |
ttaaaaaattctaaaaattgatattatgcgttgtagttttatgtcttacataatgccttaaagttctgcacattttctttttgaatggat |
53500118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University