View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14200_low_48 (Length: 227)
Name: NF14200_low_48
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14200_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 52379167 - 52378965
Alignment:
| Q |
1 |
ttataagattttaactaaatgattgagttcaactgattaatggatttcatttaagttcaacttaaattatggataactttacttannnnnnnatcagact |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| | |||||| |
|
|
| T |
52379167 |
ttataagattttaactaaatgattgagttcaactgattaatggatttcatttaagttgaactcaaattatggataactttacttattttcttaccagact |
52379068 |
T |
|
| Q |
101 |
ctgaattgttatacttttatccttgtaacccaaaggattaagaaagaaaaagtatttacaagactaagatattgattatttcataagtgaaaaaacgttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52379067 |
ctgaattgttatacttttatccttgtaacc-aaaggattaagaaagaaaaagtatttacaagactaagatattgattatttcataagtgaaaaatcgttg |
52378969 |
T |
|
| Q |
201 |
atga |
204 |
Q |
| |
|
|||| |
|
|
| T |
52378968 |
atga |
52378965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University