View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14200_low_49 (Length: 224)

Name: NF14200_low_49
Description: NF14200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14200_low_49
NF14200_low_49
[»] chr3 (1 HSPs)
chr3 (1-204)||(43159442-43159645)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 43159645 - 43159442
Alignment:
1 tttctagaaatagaagtctgacttagtagactgctttggagtgtcggcttgtgattcggtgcggaaggaagaactagggatgatgattggattgtaattg 100  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43159645 tttctagaaatagaagtctgacttagtaaactgctttggagtgtcggcttgtgattcggtgcggaaggaagaactagggatgatgattggattgtaattg 43159546  T
101 gttactacaaaatacgtaaaaagagaggtttaatttccatnnnnnnnnnnnnnnnnntgtttggtaccagcactacaagtctgcaattgtcacatagagt 200  Q
    ||| ||||||||||||||||||||||||||||||||||||                 |||||||||||||| ||||||||||||||||||||||||||||    
43159545 gtttctacaaaatacgtaaaaagagaggtttaatttccataaaaataaaataaaaaatgtttggtaccagctctacaagtctgcaattgtcacatagagt 43159446  T
201 aata 204  Q
    ||||    
43159445 aata 43159442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University