View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14201_low_3 (Length: 258)
Name: NF14201_low_3
Description: NF14201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14201_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 22 - 237
Target Start/End: Complemental strand, 17413043 - 17412832
Alignment:
| Q |
22 |
agccacttacttcaaaaccctctctccccactttctcttgttcattgcttcttgtttccttgttcctttctgcattttctcaacaatggccaacgacgac |
121 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
17413043 |
agccacttacttcaaaaccctct-tccccactttctcttgttcattgcttcttgtttccttgttcctttcttcattttctcaacaatgaccaacgacgac |
17412945 |
T |
 |
| Q |
122 |
gacaacaatgttttcccaatgggaggtttcaaattttgtaagaatatttctctctatatttccacaatatctctgtctcatgtttttattaannnnnnna |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17412944 |
---aacaatgttttcccaatgggaggtttcaaattttgtaagaatatttctctctatatttccacaatatctctgtctcatgtttttattaattttttta |
17412848 |
T |
 |
| Q |
222 |
ttatgcaatgttttcc |
237 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
17412847 |
ttatgcaatgttttcc |
17412832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University