View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14203_high_2 (Length: 506)
Name: NF14203_high_2
Description: NF14203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14203_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 2e-53; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 369 - 488
Target Start/End: Complemental strand, 34339324 - 34339203
Alignment:
| Q |
369 |
gtacaattctaaatagtacaattgcacatagttttattcactcctcaaaataaaataagataaaggaagagaataatagaaatcggggat--aggggaaa |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
34339324 |
gtacaattctaaatagtacaattgcacatagttttattcactcctcaaaataaaataagataaaggaagagaataatagaaatcggggatccagggaaaa |
34339225 |
T |
|
| Q |
467 |
ttaggaaggcacatggtgtgga |
488 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34339224 |
ttaggaaggcacatggtgtgga |
34339203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 34339541 - 34339471
Alignment:
| Q |
150 |
atggccctagtcttgtgaaaacggtagagcgtgagatacgttacattaatcaaagaagataatatctagtg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34339541 |
atggccctagtcttgtgaaaacggtagagcgtgagatacgttacattaatcaaagaagataatatctagtg |
34339471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 13 - 69
Target Start/End: Complemental strand, 34339678 - 34339622
Alignment:
| Q |
13 |
atcatcaccgtacatgtaatagggttttttctgacaggtgggtttatcgtttgccac |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34339678 |
atcatcaccgtacatgtaatagggttttttctgacaggtgggtttatcgtttgccac |
34339622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University