View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14203_low_8 (Length: 243)
Name: NF14203_low_8
Description: NF14203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14203_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 14992401 - 14992336
Alignment:
| Q |
16 |
gatagtatggttgatatagagaaaattaacttgaatgaaatgagttgcaaagaaataatgaattac |
81 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14992401 |
gataatatggttgatatagagaaaattaacttgaaggaaatgagttgcaaagaaataatgaattac |
14992336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 243
Target Start/End: Complemental strand, 14992226 - 14992174
Alignment:
| Q |
191 |
agtaaggaattgaatgcatcccaaaagcattgattcaaataatctatcaattc |
243 |
Q |
| |
|
||||||| ||||||| ||| ||||||| ||||||||||| |||||||| |||| |
|
|
| T |
14992226 |
agtaaggcattgaatacattccaaaagtattgattcaaagaatctatcgattc |
14992174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 76
Target Start/End: Original strand, 12913345 - 12913381
Alignment:
| Q |
40 |
attaacttgaatgaaatgagttgcaaagaaataatga |
76 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
12913345 |
attaacttgaaggaaatgagttgcgaagaaataatga |
12913381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 76
Target Start/End: Complemental strand, 12922750 - 12922714
Alignment:
| Q |
40 |
attaacttgaatgaaatgagttgcaaagaaataatga |
76 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
12922750 |
attaacttgaaggaaatgagttgcgaagaaataatga |
12922714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University