View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14203_low_9 (Length: 210)
Name: NF14203_low_9
Description: NF14203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14203_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 195
Target Start/End: Original strand, 279084 - 279264
Alignment:
| Q |
15 |
tgaaccaaaatatggacatcttaaaagactccatgctgccataaagttaggagagaaggttcgtaccaatggcactgctacttgggagagtcatggagat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
279084 |
tgaaccaaaatatggacatcttaaaagactccatgctgccataaagttaggagagaaggttctcaccaatggcactgctacttgggagagtcatggagat |
279183 |
T |
 |
| Q |
115 |
tatttatggatgactacttatacaaataaggacactggacaaaaaatttgttttttgagtaattcacatacctctaaagat |
195 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
279184 |
tctttatggatgactacttatacaaataagggcactggacaaaaattttgttttttgagtaattcacatacctctaaagat |
279264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University