View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14205_high_13 (Length: 335)
Name: NF14205_high_13
Description: NF14205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14205_high_13 |
 | |
|
| [»] scaffold0189 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0189 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 225
Target Start/End: Complemental strand, 20818 - 20597
Alignment:
| Q |
4 |
tgtattctcgcaaatctacaatctctgtcttgtacgagttatagccacatatagttgtttaagctcagaacacaaaaggttgtgtttggaatcattgaaa |
103 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20818 |
tgtattctcgcaaatccacaatctctgtcttgtacgagttatagccacatatagttgtttaagctcagaacacaaaaggttgtgtttggaatcattgaaa |
20719 |
T |
|
| Q |
104 |
ctgggaaaagacttggattctgtaggttccagcatatcttgttcattcatatactcataaatcaccctccagtgattttccaatggtgaagtgccaaaaa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20718 |
ctgggaaaagacttggattctgtaggttccagcatatcttgttcattcatatactcataaatcaccctccattgattttccaatggtgaagtgccaaaaa |
20619 |
T |
|
| Q |
204 |
agttgtacagcagtacatcctg |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20618 |
agttgtacagcagtacatcctg |
20597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 279 - 326
Target Start/End: Complemental strand, 20543 - 20496
Alignment:
| Q |
279 |
gaatcagacaagatggttttttaactacctgaaactcaagccctttgc |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20543 |
gaatcagacaagatggttttttaactacctgaaactcaagccctttgc |
20496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University