View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_high_21 (Length: 343)
Name: NF14206_high_21
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 4 - 325
Target Start/End: Complemental strand, 10980584 - 10980260
Alignment:
| Q |
4 |
gagcagagaaagcaccaaaaccaaggatgatagagtatccaactccttgattaagcacaggtttgccttcaaagaaacttgcttgtctcacacatccacc |
103 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10980584 |
gagcaaagaaagcaccaaaaccaaggatgatagagtatccaactccttgattaagcacaggtttgccttcaaagaaacttgcttgtctcacacatccacc |
10980485 |
T |
 |
| Q |
104 |
tccattttcatgatagtatttgctagaaaattcaaagggtggacactgtgatgaagaagccatgaaggaaattaaagaactatttttgatttagttattt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10980484 |
tccattttcatgatagtatttgctagaaaattcaaagggtggacactgtgatgaagaagccatgaaggaaattaaagaactatttttgatttagttattt |
10980385 |
T |
 |
| Q |
204 |
gatgttatttatcatcattcaatgaaactataatacctatgcagcagcnnnnnnncctaagtatttag---ttattttttaacagatcatagcggaaatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10980384 |
gatgttatttatcatcattcaatgaaactataatacctatgcagcagctttttttcctaagtatttagttattattttttaacagatcatagcggaaatt |
10980285 |
T |
 |
| Q |
301 |
tagaggcttatctctattgagtagc |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10980284 |
tagaggcttatctctattgagtagc |
10980260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University