View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_high_38 (Length: 256)
Name: NF14206_high_38
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 14192634 - 14192413
Alignment:
| Q |
6 |
agcagcacagatcttttccctggtttcaaatattgggtcttcggcatctattgctggctgattaagtttactgagaaactgtaacagaaaacaaccatcc |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| || |||||||| ||| || | |||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
14192634 |
agcagcacacatcttttccctggtttcaaatattgggtcttggggatctattgttgggtgttcaagtctactgagaagctgtaacagaaaacaaccatcc |
14192535 |
T |
 |
| Q |
106 |
aatatcattgttctcccgataacatctgcagttaattctgaacctaagatgctagcatcatagcttgcgcgggtgtctatttcaaatatgggaatatcta |
205 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14192534 |
aatatcatttttctcccgataacatctgtagttaattctgaacctaagatgctaccatcatagcttgcgcggatgtctatttcaaatatgggaatatctt |
14192435 |
T |
 |
| Q |
206 |
cgttacatgcccttaacattgt |
227 |
Q |
| |
|
|| ||||||| |||||| |||| |
|
|
| T |
14192434 |
cgctacatgcacttaaccttgt |
14192413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University