View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_high_4 (Length: 501)
Name: NF14206_high_4
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 2e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 1193897 - 1193790
Alignment:
| Q |
1 |
aaaaatataaaatttgagnnnnnnncctttcaaatttgtcagctaaccaccaataattacaataaaccacaaaagaaacaggataatgcaagatttctta |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1193897 |
aaaaatataaaatttgagtttttttcctttcaaatttgtcagctaaccaccaataattacaataaaccacaaaagaaacaggataatgcaagatttctta |
1193798 |
T |
 |
| Q |
101 |
gattacta |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
1193797 |
gattacta |
1193790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University