View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_high_41 (Length: 246)
Name: NF14206_high_41
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_high_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 239
Target Start/End: Original strand, 48276552 - 48276783
Alignment:
| Q |
8 |
tatattacaggtttgttccagtcgcttatgtatgaagctgttgggagaactataaatccagtaaatggagcagttgggctgttatggactggaaagtggc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276552 |
tatattacaggtttgttccagtcgcttatgtatgaagctgttgggagaactataaatccagtaaatggagcagttgggctgttatggactggaaagtggc |
48276651 |
T |
|
| Q |
108 |
aattctgtcaacttggtgttgaacaagtgctgagaggtaacggcggctcgttgactgcactccctcatcagttgttaggtttggatcatgatagtagttc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
48276652 |
aattctgtcaacttggtgttgaacaagtgctgagaggtaacggcggcgcgttgacggcactccctgatcagttgttaggtgtggatcatgatagtagttc |
48276751 |
T |
|
| Q |
208 |
aattcatcatcaatatcaccaacaccaatctg |
239 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
48276752 |
aattcatcatcaatatcaccaacagcaatctg |
48276783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University