View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_high_42 (Length: 241)
Name: NF14206_high_42
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 45086666 - 45086515
Alignment:
| Q |
1 |
tcaagttgatcttcaacaatcggatgcaacatcatctcatttcnnnnnnnacccatcttcactttgaaaaaaccataaaatattgagtatatttaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45086666 |
tcaagttgatcttcaacaatcggatgcaacatcatctcattt-tttttttacccatcttcactttgaaaaaaccataaaatattgagtatatttaattat |
45086568 |
T |
 |
| Q |
101 |
gaatctattgtaaacttttgatatggttgtttatatataatgatgttttcttt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45086567 |
gaatctattgtaaacttttgatatggttgtttatatataatgatgttttcttt |
45086515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 145 - 191
Target Start/End: Complemental strand, 45085621 - 45085575
Alignment:
| Q |
145 |
gttttctttatatcaagatttatttttgttcgttgattatcaaaatg |
191 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45085621 |
gttttctttatatcaagatttattttttttcgttgattatcaaaatg |
45085575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University