View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_high_43 (Length: 237)
Name: NF14206_high_43
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 28 - 222
Target Start/End: Complemental strand, 48276458 - 48276264
Alignment:
| Q |
28 |
tatacatgatctttggttgggatgaacaggtgaaaggaaagacatgagggtggcacggccaaagaacttggtgacaaagacagtggcgttagcctgtgct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276458 |
tatacatgatctttggttgggatgaacaggtgaaaggaaagacatgagggtggcacggccaaagaacttggtgacaaagacagtggcgttagcctgtgct |
48276359 |
T |
 |
| Q |
128 |
tgtgggttttgtatccacgttagacaatctcttaacatgcaatcctcactgcatccctttctcaaaactcggcaaccgttgcaactcattttatt |
222 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276358 |
tgtggattttgtatccacgttagacaatctcgtaacatgcaatcctcactgcatccctttctcaaaactcggcaaccgttgcaactcattttatt |
48276264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 48276512 - 48276483
Alignment:
| Q |
1 |
tttgaaccagatacatcaacttttatttat |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48276512 |
tttgaaccagatacatcaacttttatttat |
48276483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University