View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_high_51 (Length: 205)
Name: NF14206_high_51
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 50746808 - 50746741
Alignment:
| Q |
1 |
aaaataaaggaacaagctcttaataatttcttcactttggcgtgaagggatagatataataacaaatc |
68 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50746808 |
aaaataaaggaacaagctcttgataatttcttcactttggcgtgaagggataaatataataacaaatc |
50746741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 188
Target Start/End: Complemental strand, 50746649 - 50746615
Alignment:
| Q |
154 |
aatgaaatgaaatgaaggaagagattgattgatat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
50746649 |
aatgaaatgaaatgaaggaagagattgattgatat |
50746615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University