View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_low_26 (Length: 320)
Name: NF14206_low_26
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 26616349 - 26616191
Alignment:
| Q |
1 |
gttatacattgttgcctgtactcataataaattacaaattattaattaacctaatactnnnnnnnnnnttagtactaattttgtatgatcttaaatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26616349 |
gttatacattgttgcctgtactcataataaattacaaattattaattaacctaatactaaaaaaaaa-ttagtactaattttgtatgatcttaaatgatt |
26616251 |
T |
|
| Q |
101 |
atgggagggaaatgcttacttgagggtacccgtattcaggagtgtaggtagggtagctgc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616250 |
atgggagggaaatgcttacttgagggtacccgtattcaggagtgtaggtagggtagctgc |
26616191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 210 - 301
Target Start/End: Complemental strand, 26616141 - 26616050
Alignment:
| Q |
210 |
acgttgaatgcagtaatgtaattgtttcttagagaagcaacaacttaaaatggtagagttctattgttgtggactagtagtatagtgaagtt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26616141 |
acgttgaatgcagtaatgtaattgtttcttagagaagcaacaacttaaaatggtagagttctattgttgtgggctagtagtatagtgaagtt |
26616050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University