View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_low_43 (Length: 253)
Name: NF14206_low_43
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_low_43 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 93 - 253
Target Start/End: Original strand, 28833629 - 28833791
Alignment:
| Q |
93 |
cctcaaacaatctttgacatgataacttgctacctaagggacagtaaaaatttaactctcaaataagtattaaatgatgaaagaaacactaaagccaaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28833629 |
cctcaaacaatctttgacatgataacttgctacctaagggacagtaaaaatttaactctcaaataagtattaaatgatgaaagaaatactaaagccaaat |
28833728 |
T |
|
| Q |
193 |
tatataaagtgtgaacatattgct--nnnnnnngtttgctcatatcaacacactaatttacta |
253 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
28833729 |
tatataaagtgtgatcatattgctaaaaaaaaagtttggtcatatcaacacactaatttacta |
28833791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 71
Target Start/End: Original strand, 28833583 - 28833638
Alignment:
| Q |
16 |
atcagactatacgatgtttttcaagtttacttttagcaagttttaacctcaaacaa |
71 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
28833583 |
atcagactatacgatgtttttcaagtttagtttttgcaagttttaacctcaaacaa |
28833638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University