View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_low_50 (Length: 236)
Name: NF14206_low_50
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 5173089 - 5173308
Alignment:
| Q |
1 |
gatgagtctttctttccagaacaattctgagttgattttgtaaccatgctaccagaaggaaatgaaaatgaaaatttcccttcttttccgtcaaaaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173089 |
gatgagtctttctttccagaacaattctgagttgattttgtaaccatgctaccagaaggaaatgaaaatgaaaatttcccttcttttccgtcaaaaagtt |
5173188 |
T |
 |
| Q |
101 |
ttgccttgagtgcaccaagaagaccgtgttcttaacctgaacccgagtcactgacatcttcaaaagaaaaaggttctgtattctcgagcatgaatttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5173189 |
ttgccttgagtgcaccaagaagaccgtgttctgaacctgaacccgagtcactgacatcttcaaaagaaaaaggttctgtattctctagcatgaatttgga |
5173288 |
T |
 |
| Q |
201 |
accagcaccgcgctttgaac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5173289 |
accagcaccgcgctttgaac |
5173308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University