View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_low_51 (Length: 234)
Name: NF14206_low_51
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 28 - 213
Target Start/End: Original strand, 23994251 - 23994439
Alignment:
| Q |
28 |
tcctaatcaatggttctaatccttatgataaatatcctaatcaatggttctaattttctattttgaacnnnnnnntaaaattgaaagtgagatg---cac |
124 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||| || |
|
|
| T |
23994251 |
tcctaatcaacggttctaatccttataataaatatcctaatcaatggttctaattttctattttgaacaaaaaattaaaattgagagtgaaatgtgcaac |
23994350 |
T |
|
| Q |
125 |
aacaagtagtagaaaatggaaagaaaaatagtaccagaaagcgtgaaagaagaggattgtgatgaagaaatggtagttgcagtagagat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23994351 |
aacaagtagtagaaaatggaaagaaaaatagtaccggagagcgtgaaagaagaggattgtgatgaagaaatggtagttgtagtagagat |
23994439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University