View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14206_low_53 (Length: 227)
Name: NF14206_low_53
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14206_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 45085413 - 45085184
Alignment:
| Q |
1 |
aataaagaaactaaaattattttagagcaaattgaatcgttgttttcttttcagtgttatttgttagtactgcacc----aaaattgttgtgatctttta |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
45085413 |
aataaagaaactaaaattattttagagcaaattgaatcgttgttttcttttcagtgttatttgttagtaatgcaccaaaaaaaattgttgtgatctttta |
45085314 |
T |
|
| Q |
97 |
gataagctaaga----ttactannnnnnnnggtacaaaatgtttttggttttcttattggataagagatagatacannnnnnnaagggaagaaatagata |
192 |
Q |
| |
|
|||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45085313 |
gataagctaagattttttaattttttttttggtacaaaatgtttttggttttcttattggataagagatagatacatttttttaagggaagaaatagata |
45085214 |
T |
|
| Q |
193 |
tatttgaattttattgttggagtcgtttat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45085213 |
tatttgaattttattgttggagtcgtttat |
45085184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University