View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14206_low_60 (Length: 205)

Name: NF14206_low_60
Description: NF14206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14206_low_60
NF14206_low_60
[»] chr3 (2 HSPs)
chr3 (1-68)||(50746741-50746808)
chr3 (154-188)||(50746615-50746649)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 50746808 - 50746741
Alignment:
1 aaaataaaggaacaagctcttaataatttcttcactttggcgtgaagggatagatataataacaaatc 68  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
50746808 aaaataaaggaacaagctcttgataatttcttcactttggcgtgaagggataaatataataacaaatc 50746741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 188
Target Start/End: Complemental strand, 50746649 - 50746615
Alignment:
154 aatgaaatgaaatgaaggaagagattgattgatat 188  Q
    |||||||||||||||||||||||||||||||||||    
50746649 aatgaaatgaaatgaaggaagagattgattgatat 50746615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University