View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14207_low_1 (Length: 272)
Name: NF14207_low_1
Description: NF14207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14207_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 981033 - 980776
Alignment:
| Q |
1 |
acgaaatggtttgttctaatgtg-agaatcatattttggttgtatttttgcaaatttagtttcaggttacctaccatactataactttttctttgcttta |
99 |
Q |
| |
|
||||||||||| |||| |||||| | |||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
981033 |
acgaaatggtt-gttccaatgtgtaaaatcatattttggtagtatttttgcaaatttagtttcaggttacctatcatactctaactttttctttgcttta |
980935 |
T |
 |
| Q |
100 |
acataatgtgataggagacagatttgagaagacccatttgtcgagctgaggttatagtgacaacttggttaaggaaagacagaacctattcaactaaata |
199 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
980934 |
acataatatgataggagacagaattgagaagacccatttgtcgagctgaggttatagtgacaacttggttgaagaaagacggaacctattcaactaaata |
980835 |
T |
 |
| Q |
200 |
tgcagaaaacatggttgtaagtttgtatag--cttttttacccaattgtaggtacctct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
980834 |
tgcagaaaacatggttgtaagtttgtatagattttttttacccagttgtaggtacctct |
980776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University