View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14208_high_3 (Length: 363)
Name: NF14208_high_3
Description: NF14208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14208_high_3 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0194 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 1 - 346
Target Start/End: Original strand, 25759 - 26104
Alignment:
| Q |
1 |
tacgaacagcttttgaagtatcgagttggcgaaacatcgggtgaaaacaacaacggaatggtggataattacatgcctcagacacaaacttcaggaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25759 |
tacgaacagcttttgaagtatcgagttggcgaaacatcgggtgaaaacaacaacggaatggtggataattacatgcctcagacacaaacttcaggaggat |
25858 |
T |
 |
| Q |
101 |
tttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgcagtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25859 |
tttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgcagtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtat |
25958 |
T |
 |
| Q |
201 |
cgaagacccggtttattttctcaagtttcctgtcttaaacaataagatagaagaccaaaacttgatgttaagtggtgatgatgggttaggagaaaatgac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25959 |
cgaagacccggtttattttctcaagtttcctgtcttaaacaataagatagaagaccaaaacttgatgttaagtggtgatgatgggttaggagaaaatgac |
26058 |
T |
 |
| Q |
301 |
gagaggttcaaattaacaagcttggaggataaatcaagagatcaac |
346 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26059 |
gagaggttcaaattaacaagcgtggaggataaatcaagagatcaac |
26104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University