View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14208_high_9 (Length: 254)
Name: NF14208_high_9
Description: NF14208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14208_high_9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 46538249 - 46538491
Alignment:
| Q |
12 |
tgagatgaagggagcatctattaatggtatatggtttatttattattgtgtttgttgtacttgtatgtatggtttgaagtttatgctacttcatcactgt |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46538249 |
tgagatggagggagcatctattaatggtatatggtttatttattattgtgtttgttgtacttgtatgtatggtttgaagtttatgctacttcatcactgt |
46538348 |
T |
|
| Q |
112 |
ttgaacataagtgtattgatgagttacattcttgattttcctttgtttggatttttgtactgttacctattggaccggattggatagtatttttatatag |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46538349 |
ttgaacataagtgtattgatgagttacattcttgattttcctttgtttggatttttgtactgttacctattggactggattggatagtatttttatatag |
46538448 |
T |
|
| Q |
212 |
atctgttgtctctttgttgatcactatctcattcactattttc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46538449 |
atctgttgtctctttgttgatcactatctcattcactattttc |
46538491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University