View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14208_low_5 (Length: 363)
Name: NF14208_low_5
Description: NF14208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14208_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 46538427 - 46538682
Alignment:
| Q |
1 |
attggatagtagttgtatatagatctgttgtctcttgtttgatcactatctcattcacgattttccattaaatgtgcacatgtcattccaattagaggcg |
100 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46538427 |
attggatagtatttttatatagatctgttgtctctttgttgatcactatctcattcactattttccattaaatgtgcacatgtcattccaattagaggcg |
46538526 |
T |
 |
| Q |
101 |
ttttcatcctctgcagatggcaatgtttgtcgacgcagctcagtagtgtgatttaatgtgtcaacaaag-nnnnnnncacagatatcactttgtgtttta |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46538527 |
ttttcatcctctgcagatgccaatgtttgtcgacgcagctcagtagtgtgatttaatgtgtcaacaaagaaaaaaaacacagatatcactttgtgtttta |
46538626 |
T |
 |
| Q |
200 |
ttgcccttgtgatcgtcatggtttataattattcaacttaactcatttctcgtttt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
46538627 |
ttgcccttgtgatcgtcatggtttataattattgaactcaactcatttctcgtttt |
46538682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 276 - 345
Target Start/End: Original strand, 46538680 - 46538749
Alignment:
| Q |
276 |
tttggacccccctcctaatacctcaacatttattcaagtattccacccttattttttctctatctctctt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46538680 |
tttggacccccctcctaatacctcaacatttattcaagtattccacccttattttttctctatctctctt |
46538749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University