View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1420_high_3 (Length: 560)
Name: NF1420_high_3
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1420_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 507; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 507; E-Value: 0
Query Start/End: Original strand, 20 - 550
Target Start/End: Complemental strand, 7525150 - 7524620
Alignment:
| Q |
20 |
ctgaagtcatcgtcggtgtccttgacaccggtatatggcccgaactcagaagcttttcaacatctgatgattcaaattcattaaaaagtctgaattcttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7525150 |
ctgaagtcatcgtcggtgtccttgacaccggtatatggcccgaactcagaagcttttcaacatctgatgattcaaattcattaaaaagtctgaattcttg |
7525051 |
T |
 |
| Q |
120 |
gaaaggaaaatgtgaaattagtaaagattttccttcttcttcatgtaactctaactccaagattatcggagcgaaagctttttataaaggctatgaagca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7525050 |
gaaaggaaaatgtgaaattagtaaagattttccttcttcttcatgtaactctaactccaagattatcggagcgaaagctttttataaaggctatgaagca |
7524951 |
T |
 |
| Q |
220 |
tatcttcggcgacctattgatgaaactgtggaatccaaatctcctagagatactgaaggacatggaacacatacagcttcaacagcagctggatcagttg |
319 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7524950 |
tatcttcagcgacctatcgatgaaactgtggaatccaaatctcctagagatactgaaggacatggaacacatacagcttcaacagcagctggatcagttg |
7524851 |
T |
 |
| Q |
320 |
ttggtaatgctagtttgtttggtttcgctagaggcgaagctaagggaatggcaacaaaagctagaattgctgcttataaaatctgttggaaacttggttg |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7524850 |
ttggtaatgctagtttgtttggtttcgctagaggcgaagctaagggaatggcaacaaaagctagaattgctgcttataaaatctgttggaaacttggttg |
7524751 |
T |
 |
| Q |
420 |
ttttgattctgatattcttgctgctatggatgaagctgttgctgatggggttcatgtgatttcgctttcggttggttctagtggttatgcgcctcattat |
519 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7524750 |
ttttgattctgatattcttgctgctatggatgaagctgttgctgatggggttcatgtgatttcactttcggttggttctaatggttatgcgcctcattat |
7524651 |
T |
 |
| Q |
520 |
tatcgtgattcgattgctattggtgcctttg |
550 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| |
|
|
| T |
7524650 |
tatcgtgattcgattgctatcggtgcttttg |
7524620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University