View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1420_high_34 (Length: 241)
Name: NF1420_high_34
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1420_high_34 |
 | |
|
| [»] scaffold0140 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 37015 - 36930
Alignment:
| Q |
18 |
acaagggagttggtgacaggtctagtgaattggaatgagaatattcagaagaacaaccaagcaaaaggaactgatggggaggacac |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37015 |
acaagggagttggtcacaggtctagtgaattggaatgagaatattcagaagaacaaccaagcaaaaggaactgatgggaaggacac |
36930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 171 - 241
Target Start/End: Complemental strand, 36900 - 36830
Alignment:
| Q |
171 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcaatatgatgcttatgttgaaac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36900 |
ttaatgtttaagttttactttactttttggctatgaacctattagttgcactatgatgcttatgttgaaac |
36830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University