View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1420_high_37 (Length: 227)
Name: NF1420_high_37
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1420_high_37 |
 |  |
|
| [»] scaffold0209 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 32282627 - 32282706
Alignment:
| Q |
1 |
gcatgttaagatctgaagttcgattttctttggtgtcaatttcaatggacaagtccatataaattggatgctgagttttc |
80 |
Q |
| |
|
|||||||| |||| || |||||||| ||||| ||||||||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32282627 |
gcatgttacgatccgaggttcgattccctttgttgtcaattttagtgggcaagtccatataaattggatgctgagttttc |
32282706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 30207 - 30249
Alignment:
| Q |
19 |
ttcgattttctttggtgtcaatttcaatggacaagtccatata |
61 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
30207 |
ttcgatttcttttgatgtcaatttcaatggacaagtccatata |
30249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 589152 - 589110
Alignment:
| Q |
19 |
ttcgattttctttggtgtcaatttcaatggacaagtccatata |
61 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
589152 |
ttcgatttcttttgatgtcaatttcaatggacaagtccatata |
589110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 624770 - 624812
Alignment:
| Q |
19 |
ttcgattttctttggtgtcaatttcaatggacaagtccatata |
61 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
624770 |
ttcgatttcttttgatgtcaatttcaatggacaagtccatata |
624812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 26535104 - 26535137
Alignment:
| Q |
26 |
ttctttggtgtcaatttcaatggacaagtccata |
59 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
26535104 |
ttctttggtgtcaatttcagtggacaagtccata |
26535137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University