View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1420_low_28 (Length: 291)
Name: NF1420_low_28
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1420_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 24978546 - 24978824
Alignment:
| Q |
1 |
tcccttcctttcctgaaatgtcatgagcaatagattgctcccaaaattccaattatgcaggcatttcagttgtgttatagttttgtgcaatctcatgttg |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978546 |
tcccttcctttcctgaaatgtcctgagcaatagattgctcccaaaattccaaatatgcaggcatttcagttgtgttatagttttgtgcaatctcatgttg |
24978645 |
T |
 |
| Q |
101 |
aaccagttcaatgtcagggatggcaacaagaagattatcagtatgtttcttgccattcagctcagacccaacatgattcttgccagacaagatacgagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
24978646 |
aaccagttcaatgtcagggatggcaacaagaagattatcagtatgtttcttgccattcagctcagacccaacatgattcttg-cagacaaggtacgagca |
24978744 |
T |
 |
| Q |
201 |
acaatgttcttgccaggcataacattgtcaacttgtttcttgctagacaagccattatcaacttgtttctttccattcat |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978745 |
acaatgttcttgccaggcataacattgtcaacttgtttcttgctagacaagccattatcaacttgtttctttccattcat |
24978824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University