View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1420_low_31 (Length: 284)
Name: NF1420_low_31
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1420_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 5 - 175
Target Start/End: Complemental strand, 3038567 - 3038402
Alignment:
| Q |
5 |
gaagaatatcaaatagagaagttccaaagtgaaactaattgagtatc-aaaatctccatgtcaccccagttataactaccaataccataatttgttgggg |
103 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3038567 |
gaagagtatcaaatagagaagttccaaagtgaaactaattgagtatcaaaaatctccatgtcaccccagttataac------taccataatttgttgggg |
3038474 |
T |
|
| Q |
104 |
aaggaggagctgaacgtaaaggctcgtttgcaatttttagaagcaaatcatgcatgccttcaaattccgatg |
175 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| |||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
3038473 |
aaggaggagctgaacgtaaaggctcattggcaatacttagaagcaaatgatgcatgtcttcaaattctgatg |
3038402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 13 - 175
Target Start/End: Complemental strand, 3021690 - 3021533
Alignment:
| Q |
13 |
tcaaatagagaagttccaaagtgaaactaattgagtatc-aaaatctccatgtcaccccagttataactaccaataccataatttgttggggaaggagga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3021690 |
tcaaatagagaagttccaaagtgaaactaattgagtatcaaaaatctccatgtcaccccagttataac------taccataatttgttggggaaggagga |
3021597 |
T |
|
| Q |
112 |
gctgaacgtaaaggctcgtttgcaatttttagaagcaaatcatgcatgccttcaaattccgatg |
175 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
3021596 |
gctgaacgtaaaggctcattggcaatacttagaagcaaatgatgcatgtcttcaaattctgatg |
3021533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 219 - 269
Target Start/End: Complemental strand, 3021447 - 3021397
Alignment:
| Q |
219 |
cttgtcctcaaccgcaaacaactgagctgcctccatcgccgctctccttat |
269 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
3021447 |
cttgtcttcaaccgcaaacaactgagcagcctccatcgccgccctccttat |
3021397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 219 - 269
Target Start/End: Complemental strand, 3038316 - 3038266
Alignment:
| Q |
219 |
cttgtcctcaaccgcaaacaactgagctgcctccatcgccgctctccttat |
269 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
3038316 |
cttgtcttcaaccgcaaacaactgagcagcctccatcgccgccctccttat |
3038266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 93 - 170
Target Start/End: Complemental strand, 32752584 - 32752507
Alignment:
| Q |
93 |
atttgttggggaaggaggagctgaacgtaaaggctcgtttgcaatttttagaagcaaatcatgcatgccttcaaattc |
170 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| || ||||| | | |||||||||||||||| |||| ||||| |
|
|
| T |
32752584 |
atttgtaggggaaggaggattagaacgtaaaggctcattagcaatactcaaaagcaaatcatgcatgtcttccaattc |
32752507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University