View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1420_low_34 (Length: 271)
Name: NF1420_low_34
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1420_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 54878647 - 54878887
Alignment:
| Q |
12 |
atgaatgtgtggttgtttgttcatactgaagagattccttctgctattaagccttatagagattttcagaaagagaagaagcttgaagaaaatgatttta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878647 |
atgaatgtgtggttgtttgttcatactgaagagattccctctgctattaagccttatagagattttcagaaagagaagaagcttgaagaaaatgatttta |
54878746 |
T |
|
| Q |
112 |
ctggtgctgtttttgaagggaaattttatggtcctgatgagtttaagaaacttgaaacattgccgacacgtggcgagatttatgctaatttgttgggttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878747 |
ctggtgctgtttttgaagggaaattttatggtcctgatgagtttaagaaacttgaaacattgccgacacgtggcgagatttatgctaatttgttgggttc |
54878846 |
T |
|
| Q |
212 |
attgaaaagtccttcttctgctttggttactaccattcaag |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54878847 |
attgaaaagtccttcttctgctttggttactaccattcaag |
54878887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University