View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1420_low_42 (Length: 230)

Name: NF1420_low_42
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1420_low_42
NF1420_low_42
[»] chr8 (1 HSPs)
chr8 (1-214)||(30017548-30017761)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 30017548 - 30017761
Alignment:
1 ttggacatgaatttggaaaaccaaatacagctgaagaattggaaaacactaagaaacttacagaagaacttaaactcaacttagaaagtgtagaaagaga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
30017548 ttggacatgaatttggaaaaccaaatacagctgaagaattggaaaacactaagaaacttacagaagaactcaaactcaacttagaaagtgtagaaagaga 30017647  T
101 tgagcttcaggtaaaagaagaagtggaacttgtgattcgaaaaattgaggagctggagcaagaccttgcagatgaagccagttttgaagccaaagcacaa 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30017648 tgagcttcaggtgaaagaagaagtggaacttgtgattcgaaaaattgaggagctggagcaagaccttgcagatgaagccagttttgaagccaaagcacaa 30017747  T
201 cttgaggttgaaaa 214  Q
    ||||||||||||||    
30017748 cttgaggttgaaaa 30017761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University