View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1420_low_42 (Length: 230)
Name: NF1420_low_42
Description: NF1420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1420_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 30017548 - 30017761
Alignment:
| Q |
1 |
ttggacatgaatttggaaaaccaaatacagctgaagaattggaaaacactaagaaacttacagaagaacttaaactcaacttagaaagtgtagaaagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30017548 |
ttggacatgaatttggaaaaccaaatacagctgaagaattggaaaacactaagaaacttacagaagaactcaaactcaacttagaaagtgtagaaagaga |
30017647 |
T |
 |
| Q |
101 |
tgagcttcaggtaaaagaagaagtggaacttgtgattcgaaaaattgaggagctggagcaagaccttgcagatgaagccagttttgaagccaaagcacaa |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30017648 |
tgagcttcaggtgaaagaagaagtggaacttgtgattcgaaaaattgaggagctggagcaagaccttgcagatgaagccagttttgaagccaaagcacaa |
30017747 |
T |
 |
| Q |
201 |
cttgaggttgaaaa |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30017748 |
cttgaggttgaaaa |
30017761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University