View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14210_high_21 (Length: 323)
Name: NF14210_high_21
Description: NF14210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14210_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 1561128 - 1560822
Alignment:
| Q |
1 |
gaaagatcacccaatgatataatctttgttgatggatctctttccgtcgagcatctaatgcatagggtgaaactttctttgtgcaagtggttccttggta |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1561128 |
gaaagctcacccaatgatataatctttgttggtggatctctttccgtcgagcatctgatgcatagggtgaaactttctttgtgcaagtggttccttggta |
1561029 |
T |
 |
| Q |
101 |
aaaaaccttggtagcatctgctcatgtgctggtattgatcgagtttgatggtgtgggttttggggcccgattgtgtttgtatggtttggcttctacttct |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1561028 |
aaaaaccttggtagcatctactcatgtgctg------atcgagtttgatggtgtgggctttggggcccgattgtgtttgtatggtttggcttctacttct |
1560935 |
T |
 |
| Q |
201 |
caatcgtccatctgtgcttgggaggtttgtgtcatggaccatgttggatgttcacctttagtttgtgtgttcatgtgccacatatcttgttggttgttca |
300 |
Q |
| |
|
|| |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
1560934 |
cagtcgtccatttgtgcttggaaggtttgtgtcatggaccatgttggatgttcacctttagtctgtgtgttcatgtggcacataacttgttggttgttca |
1560835 |
T |
 |
| Q |
301 |
tctttgctctgtg |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1560834 |
tctttgctctgtg |
1560822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University