View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14210_high_28 (Length: 307)
Name: NF14210_high_28
Description: NF14210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14210_high_28 |
 | |
|
| [»] chr3 (5 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 84 - 307
Target Start/End: Original strand, 38792128 - 38792353
Alignment:
| Q |
84 |
gccaatcatcaccggaacaaccaatcatgcagaccctcatgtcgtgactgcagaaaatcagacaacagttcaaactaaaaacatcgtaacgacaatgtaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792128 |
gccaatcatcaccggaacaaccaatcatgcagactctcatgtcgtgactgcagaaaaccagacaacagttcaaactaaaaacatcgtaacgacaatgtaa |
38792227 |
T |
|
| Q |
184 |
tcttggcttttgatgtctggatcattcaac--ttgtgtctctatgatgattatgttgattttcatatcctacaaagagagacaaagaggttgtattcccg |
281 |
Q |
| |
|
||||||||||||||| |||||||||||||| || | | ||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38792228 |
tcttggcttttgatggctggatcattcaacagttcaaac-caatgatgattgtgttgattttcatatcctacaaagagaggtaaagaggttgtattcccg |
38792326 |
T |
|
| Q |
282 |
catagtaaaaaa-caacatgttgtatt |
307 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
38792327 |
catagtaaaaaaccaacatgttgtatt |
38792353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 181 - 240
Target Start/End: Original strand, 407932 - 407991
Alignment:
| Q |
181 |
taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
407932 |
taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat |
407991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 181 - 240
Target Start/End: Complemental strand, 416010 - 415951
Alignment:
| Q |
181 |
taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
416010 |
taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat |
415951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 228
Target Start/End: Original strand, 6457721 - 6457759
Alignment:
| Q |
190 |
cttttgatgtctggatcattcaacttgtgtctctatgat |
228 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
6457721 |
cttttgatggctggatcattcaacttgcgtctctatgat |
6457759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 190 - 240
Target Start/End: Complemental strand, 49962806 - 49962756
Alignment:
| Q |
190 |
cttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat |
240 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||| ||| ||| ||||||| |
|
|
| T |
49962806 |
cttttgatggctggatcattcaacttgcgtctctaagattattgtgttgat |
49962756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 181 - 240
Target Start/End: Original strand, 24184414 - 24184473
Alignment:
| Q |
181 |
taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
24184414 |
taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat |
24184473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 181 - 240
Target Start/End: Complemental strand, 24357865 - 24357806
Alignment:
| Q |
181 |
taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
24357865 |
taatcttggcttttgatggctggatcattcaacttatgtctctgtgatgattgtgttgat |
24357806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 181 - 240
Target Start/End: Complemental strand, 24345592 - 24345535
Alignment:
| Q |
181 |
taatcttggcttttgatgtctggatcattcaacttgtgtctctatgatgattatgttgat |
240 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
24345592 |
taatcttggcttttgatggctggatcattcaacttatgtctc--tgatgattgtgttgat |
24345535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University