View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14211_high_11 (Length: 244)
Name: NF14211_high_11
Description: NF14211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14211_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 226
Target Start/End: Original strand, 37062665 - 37062877
Alignment:
| Q |
16 |
gataggtcaaaatctggtgctgctcgtgctctacaaggtcttaagtttatgacaaaaaacgttggaagtgaaggttggtcccaagttgagaagcgttttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37062665 |
gataggtcaaaatctggtgctgctcgtgctctacaaggtcttaagtttatgacaaaaaacgttggaagtgaaggttggtcccaagttgagaagcgttttg |
37062764 |
T |
 |
| Q |
116 |
atgagttggctgtggagggaaaattgcccaagactcgatttagccagtgcataggtatgt--atgttatggtctatacttcattttcatcatttactttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37062765 |
atgagttggctgtggagggaaaattgcccaagactcgatttagccagtgcataggtatgtccatgttatggtctatacttccttttcatcatttactttt |
37062864 |
T |
 |
| Q |
214 |
gtttgcctaaaaa |
226 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
37062865 |
gtttgcgtaaaaa |
37062877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 173
Target Start/End: Complemental strand, 46565885 - 46565725
Alignment:
| Q |
16 |
gataggtcaaaatctggtgctgctcgtgctctacaaggtcttaagtttatgacaaaaaacgttggaagtga---aggttggtcccaagttgagaagcgtt |
112 |
Q |
| |
|
|||||| | |||||||||||||||||||| || |||| |||||||||||||| ||||||||||| | ||| |||||||| || || |||||||| | |
|
|
| T |
46565885 |
gatagggcgaaatctggtgctgctcgtgcactgaaaggacttaagtttatgaccaaaaacgttggtactgatcgtggttggtctcaggtggagaagcgat |
46565786 |
T |
 |
| Q |
113 |
ttgatgagttggctgtggagggaaaattgcccaagactcgatttagccagtgcataggtat |
173 |
Q |
| |
|
||||||| |||| || || |||||| | ||||| || || || ||||||||||||||||| |
|
|
| T |
46565785 |
ttgatgaattggaagttgatggaaaactccccaaaacgcgcttcagccagtgcataggtat |
46565725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University