View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14211_low_13 (Length: 263)
Name: NF14211_low_13
Description: NF14211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14211_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 36199227 - 36199055
Alignment:
| Q |
1 |
attaaactgatacaagttaggagagagaaaatgaaaatgatgagatatgatgagaaagagattgtactctgccatatcttccagttggatcaacttcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36199227 |
attaaactgatacaagttaggagagagaaaatgaaaatgatgagatatgatgagaaagagattgtactctgccatatcttccagttggatcaacttcaac |
36199128 |
T |
|
| Q |
101 |
aaactcagaatcatcttcttcaaggtgtgtcactccattcattctctgcttctgcttgtacttgatgcttatc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36199127 |
aaactcagaatcatcttcttcaaggtgtgtcactccattcattctctgcttctgcttgtacttgatgcttatc |
36199055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 217 - 251
Target Start/End: Complemental strand, 36199006 - 36198972
Alignment:
| Q |
217 |
ctatgatttaagattaatgtatgtgccccttcctc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36199006 |
ctatgatttaagattaatgtatgtgccccttcctc |
36198972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 109
Target Start/End: Original strand, 47006725 - 47006771
Alignment:
| Q |
63 |
tgtactctgccatatcttccagttggatcaacttcaacaaactcaga |
109 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
47006725 |
tgtactcttccatatcttccagtaggatcaacttctataaactcaga |
47006771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 65 - 142
Target Start/End: Original strand, 47355140 - 47355217
Alignment:
| Q |
65 |
tactctgccatatcttccagttggatcaacttcaacaaactcagaatcatcttcttcaaggtgtgtcactccattcat |
142 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| ||||| |||||| |||||| |||||||| | |||||| |
|
|
| T |
47355140 |
tactctgccatatctaccggttggatcaacttcaacaaaatcagagtcatctgtttcaagctgtgtcacacaattcat |
47355217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University