View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14211_low_15 (Length: 243)
Name: NF14211_low_15
Description: NF14211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14211_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 83 - 237
Target Start/End: Complemental strand, 41169179 - 41169023
Alignment:
| Q |
83 |
aataatgatcttacggtttttgagtcaccctaaaaagacatttatatattaaaagaaaaagtgtatctaaactgatcaaataaattctcagaacagtgat |
182 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41169179 |
aataatgatcttacggttttttagtcaccctaaaaagacatttatatattaaaa-aaaaagtgtatctaaactgatcaaataaattctcagaacattgat |
41169081 |
T |
 |
| Q |
183 |
taaattaaataaataaaatccaactacatgta---taatgcataactacttcctaaaa |
237 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41169080 |
taaattaaataaataacatccaactacatgtataataatgcataactacttcctaaaa |
41169023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University