View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14211_low_3 (Length: 605)
Name: NF14211_low_3
Description: NF14211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14211_low_3 |
 |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 443; Significance: 0; HSPs: 27)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 443; E-Value: 0
Query Start/End: Original strand, 84 - 598
Target Start/End: Original strand, 18576710 - 18577223
Alignment:
| Q |
84 |
aaaagaagagggctaattagaaaaacacatttttctctgcatgttttctgtagcatgttttgaactgcaaccatatttttcagctcttcaattattttct |
183 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18576710 |
aaaagaagagggctaattagaaaagcacatttttctctgcatgttttctgtagaatgttttgaactgcaaccatatttttcagctcttcaatcattttct |
18576809 |
T |
 |
| Q |
184 |
ttaatgctaaacaccataagggaagtaaaatttggaactggctcaccttaaaacacttaatgcatgagaaaccatcaaaatttaagtgtttgatttgagt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18576810 |
ttaatgctaaacaccataagggaagtaaaatttggaactggctcaccttaaaacacttaatgcatgagaaaccatcaaaatttaagtgtttgatttgagt |
18576909 |
T |
 |
| Q |
284 |
gatatcaaataatggttgctataatgatgatgacaggtttacttgaaactgcaaacttttgcaagttctagaacaggaaacaataatgcaaaaaactcat |
383 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
18576910 |
gatatcaaataatggttgctata-taatgatgacaggtatacttgaaactgcaaacttttgcaagttctagaacaggaagcaataatgcaaaaaacacat |
18577008 |
T |
 |
| Q |
384 |
cagcattcctcaaggttgccactacaacattgcttcacacaataagagaatccgaggaggcgacgtatgttacacagataaataactatcttgcagaaga |
483 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18577009 |
cagcattcctcaaggttgccactacaacattgcttcacacaataagcgaatccgagaaggcgtcgtatgttacacatataaataactatcttgcagaaga |
18577108 |
T |
 |
| Q |
484 |
ggaattactcaagaaataccttcctcttgatccttcaaccaacgatctcttcgaaatcgcaaaagacggtgttcttctttggtatatgctagatattgtc |
583 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
18577109 |
tgaattcctcaagaaataccttcctcttgatccttcaaccaacgatctcttcgaaatcgcaaaagacggtgttcttctttggtatatactagatattatc |
18577208 |
T |
 |
| Q |
584 |
attttatcttcttat |
598 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
18577209 |
cttttatcttcttat |
18577223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 7879712 - 7879774
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
7879712 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt |
7879774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 16 - 75
Target Start/End: Original strand, 18747562 - 18747621
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
||||||||||| |||| ||||| |||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
18747562 |
tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 21172070 - 21172007
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
21172070 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
21172007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 31591170 - 31591107
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
31591170 |
atggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgccctttta |
31591107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 27889377 - 27889315
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||| || ||||||||||||||||| |
|
|
| T |
27889377 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttt |
27889315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 32758333 - 32758395
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
32758333 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
32758395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 38262253 - 38262195
Alignment:
| Q |
19 |
tgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||| ||||||||| |||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
38262253 |
tgggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgccctttt |
38262195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 42391161 - 42391099
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
42391161 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
42391099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 42798743 - 42798805
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||||||||||||| ||| ||| |||||| | ||| ||||||| |||||||||||||| |
|
|
| T |
42798743 |
atggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccctttt |
42798805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 42805600 - 42805662
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | |||||||||||||||||||||||||| |
|
|
| T |
42805600 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
42805662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 2541080 - 2541019
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| || |||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
2541080 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttcccttt |
2541019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 48735183 - 48735122
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||| |
|
|
| T |
48735183 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
48735122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 45018983 - 45018923
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||| |||| |||||| ||| |||||||||| | ||||||||||||| ||||||||||| |
|
|
| T |
45018983 |
tggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt |
45018923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 18512514 - 18512455
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccct |
74 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||| |||||| |||||||||| |
|
|
| T |
18512514 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgccct |
18512455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 35334877 - 35334818
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccct |
74 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| | |||||||||||||||||| |||| |
|
|
| T |
35334877 |
atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 35787330 - 35787267
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||| ||||||| |||||| ||| |||||||||| | |||| | |||||||||||||||||||| |
|
|
| T |
35787330 |
atggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgccctttta |
35787267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 40463950 - 40464013
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| ||| || ||| |||||||||| | |||| ||||||||| |||||||||||| |
|
|
| T |
40463950 |
atggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctttta |
40464013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 19426950 - 19426889
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||||| | || ||| ||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19426950 |
atggtgggaccctt-ctcggaccctgcatatgcgagagcttcagtgcaccgggttgccctttt |
19426889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 34626269 - 34626207
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||| || |||||| ||| |||||||||| | |||||||| || |||||||||||||| |
|
|
| T |
34626269 |
atggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctttt |
34626207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 39 - 77
Target Start/End: Original strand, 36602545 - 36602583
Alignment:
| Q |
39 |
tgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
36602545 |
tgcgtatgcgggagctttagtgcaccgggttgccctttt |
36602583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 10693134 - 10693073
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||| |||||||||||| |
|
|
| T |
10693134 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcccttt |
10693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 23231635 - 23231692
Alignment:
| Q |
19 |
tgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||| |||||||||| |||||||||| |||||||||||||| ||| |||||| |
|
|
| T |
23231635 |
tgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttcccttt |
23231692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 33871971 - 33871914
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcc |
72 |
Q |
| |
|
|||||||||||| ||||| ||| || ||||||||| ||||||||||||| ||||||| |
|
|
| T |
33871971 |
atggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 47716535 - 47716596
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | ||||| ||||||||||||||||||| |
|
|
| T |
47716535 |
atggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttt |
47716596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 11617649 - 11617589
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||| |||| | ||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11617649 |
atggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 15 - 67
Target Start/End: Original strand, 21566510 - 21566562
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccggg |
67 |
Q |
| |
|
||||| |||||| |||||||||| ||| |||||| | |||||||||||||||| |
|
|
| T |
21566510 |
atggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 92; Significance: 2e-44; HSPs: 31)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 314 - 567
Target Start/End: Complemental strand, 3092445 - 3092195
Alignment:
| Q |
314 |
tgacaggtttacttgaaactgcaaacttttgcaagttctagaacaggaaacaataatgcaaaaaactcatcagcattcctcaaggttgccactacaacat |
413 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| |||||||||| || | |||| || || || |||||| | |||| |||||||| |||| |
|
|
| T |
3092445 |
tgacaggtttacttgaaactgcaaacatttgcaaattcaagaacaggaagcagtc---caaagaattcctcggcattcttaaaggcagccactactacat |
3092349 |
T |
 |
| Q |
414 |
tgcttcacacaataagagaatccgaggaggcgacgtatgttacacagataaataactatcttgcagaagaggaattactcaagaaataccttcctcttga |
513 |
Q |
| |
|
|||||||||||||||| ||||| ||| || | | ||||||||||| |||||| |||||||| || |||| || || |||||||| || ||||| |||| |
|
|
| T |
3092348 |
tgcttcacacaataagtgaatctgagaagtcatcatatgttacacatataaatcactatctttcacaagatgagttcctcaagaagtatcttcccattga |
3092249 |
T |
 |
| Q |
514 |
tccttcaaccaacgatctcttcgaaatcgcaaaagacggtgttcttctttggta |
567 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
3092248 |
tccttcaaccaatgagctcttcgaaattgcaaaagatggtgttcttctttggta |
3092195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 12625964 - 12626027
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
12625964 |
atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
12626027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 16 - 75
Target Start/End: Original strand, 27507985 - 27508044
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcctt |
27508044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 39461055 - 39460992
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
39461055 |
atggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
39460992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 28817687 - 28817625
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
28817687 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccctttt |
28817625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 35261753 - 35261815
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||| | ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
35261753 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
35261815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Original strand, 45071338 - 45071398
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
45071338 |
atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 36720870 - 36720933
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
36720870 |
atggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctttta |
36720933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 44530223 - 44530286
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||| | ||| |||||||||| | ||||||||||||||||||| ||||||| |
|
|
| T |
44530223 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgacctttta |
44530286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 25250598 - 25250660
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||||||| || |||||| | | |||||||||||||||||||||||| |
|
|
| T |
25250598 |
atggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccctttt |
25250660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 26102591 - 26102653
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
26102591 |
atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttt |
26102653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 30454158 - 30454096
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
30454158 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30454096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 16 - 77
Target Start/End: Original strand, 10857904 - 10857965
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||| |||| | ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10857904 |
tggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgccctttt |
10857965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 13160775 - 13160836
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||| ||||| |||||||||||||| |
|
|
| T |
13160775 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcccttt |
13160836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 17823650 - 17823711
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||| |||| |||||||||| ||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
17823650 |
atggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcccttt |
17823711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 27468140 - 27468091
Alignment:
| Q |
28 |
ttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
27468140 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
27468091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 28407477 - 28407538
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| | |||||||| | |||||| |||||||||||||||||| |
|
|
| T |
28407477 |
atggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 5689705 - 5689761
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgc |
71 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| | | ||||||||||||||| |||| |
|
|
| T |
5689705 |
atggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 18164814 - 18164759
Alignment:
| Q |
22 |
gaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||| ||||||| ||| |||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
18164814 |
gaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccatttt |
18164759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 20284130 - 20284075
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttg |
70 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | | ||||||||||||||||| |
|
|
| T |
20284130 |
atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 70
Target Start/End: Complemental strand, 21070758 - 21070703
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttg |
70 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | | ||||||||||||||||| |
|
|
| T |
21070758 |
atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 31457246 - 31457309
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
||||| |||||| ||||| |||| |||||||||| | ||| ||||||||||| ||||||||||| |
|
|
| T |
31457246 |
atggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctttta |
31457309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 6760898 - 6760960
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||| || ||| || |||||| | |||||||||||||||||||||||||| |
|
|
| T |
6760898 |
atggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
6760960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 7136588 - 7136526
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | |||||||||||||||||| ||||||| |
|
|
| T |
7136588 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttaccctttt |
7136526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 8897825 - 8897763
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | |||||| |||||| |||||||||||| |
|
|
| T |
8897825 |
atggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttt |
8897763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 12670311 - 12670249
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||| ||||||| |
|
|
| T |
12670311 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccctttt |
12670249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 17250936 - 17250879
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccc |
73 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | ||||||||||| |||||||||| |
|
|
| T |
17250936 |
atggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgca-cgggttgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 20869999 - 20870061
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||| | ||| || |||||| | |||||||||||||||||||||||||| |
|
|
| T |
20869999 |
atggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
20870061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 35107372 - 35107310
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| || || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
35107372 |
atggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 28 - 76
Target Start/End: Original strand, 33867039 - 33867087
Alignment:
| Q |
28 |
ttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33867039 |
ttcccgaaccctgcgtatgcagaagctttagtgcaccgggttgcccttt |
33867087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt |
36486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 29)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 9671253 - 9671317
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttttag |
79 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
9671253 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttag |
9671317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 23488557 - 23488620
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
23488557 |
atggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttta |
23488620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 10546237 - 10546299
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
10546237 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10546299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 25249799 - 25249737
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||| || |||||||||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
25249799 |
atggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctttt |
25249737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 10543774 - 10543835
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
10543774 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 14530394 - 14530455
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
14530394 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
14530455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 25079778 - 25079717
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
25079778 |
atggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 8455377 - 8455314
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
8455377 |
atggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctttta |
8455314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 14444802 - 14444864
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
14444802 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctttt |
14444864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 36871566 - 36871627
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
36871566 |
atggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgccctttt |
36871627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 40762295 - 40762234
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||||||||||||| | ||| |||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
40762295 |
atggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||| |||||| ||| || ||||||| | |||||||||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 21779322 - 21779259
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
21779322 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
21779259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 27 - 78
Target Start/End: Original strand, 22371198 - 22371249
Alignment:
| Q |
27 |
tttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
||||||| ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
22371198 |
tttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
22371249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 24200684 - 24200622
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||| || |||||| ||| || ||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
24200684 |
atggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 7 - 77
Target Start/End: Complemental strand, 26684689 - 26684619
Alignment:
| Q |
7 |
tatactagatggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||| ||||||||||| |||||||||| |||||||||| | |||||| |||||||| ||| |||||| |
|
|
| T |
26684689 |
tatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccggattgtcctttt |
26684619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 34080176 - 34080238
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
||||||||||| |||||| ||| ||| |||||| | | ||||||||||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttta |
34080238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 25632583 - 25632644
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||||| | |||||||||| | |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
25632583 |
atggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcccttt |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 16 - 77
Target Start/End: Original strand, 34766330 - 34766391
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||| | ||||||||||| |||||| ||||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttccctttt |
34766391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 5841104 - 5841168
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttttag |
79 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
5841104 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttttag |
5841168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 11514510 - 11514572
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||||| || || || |||||||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
11514510 |
atggtgggacccttcccagaccc-tgcgtatgcgggagctttagtgcaccggattgccctttta |
11514572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 25641578 - 25641637
Alignment:
| Q |
18 |
gtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||| |||||||| | |||||||||||| ||||||||| ||||| ||| |||||| |
|
|
| T |
25641578 |
gtgggaccccttcccgaatcctgcgtatgcgagagctttagtgaaccggattgtcctttt |
25641637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 39914366 - 39914304
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||| || || |||||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
39914366 |
atggtgggaccccttcctgaccc-tgcgtatgcgggagctttagtgcatcgggttgccctttta |
39914304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 74
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccct |
74 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | |||| |||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 44643597 - 44643660
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| | || ||||||||||||| |||||||||| |
|
|
| T |
44643597 |
atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttta |
44643660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 5 - 75
Target Start/End: Complemental strand, 13245166 - 13245096
Alignment:
| Q |
5 |
attatactagatggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||| |||| |||||||||||| |||||| ||||||| ||| || | ||||||||| | |||||||||||| |
|
|
| T |
13245166 |
attacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt |
13245096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 17668076 - 17668138
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||| |||| ||| |||||| ||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
17668076 |
atggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctttt |
17668138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 27 - 72
Target Start/End: Complemental strand, 124963 - 124918
Alignment:
| Q |
27 |
tttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcc |
72 |
Q |
| |
|
||||||| ||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
124963 |
tttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 40416928 - 40416871
Alignment:
| Q |
19 |
tgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||||||| | ||| ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
40416928 |
tgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgcccttt |
40416871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 9e-16; HSPs: 24)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 16957388 - 16957451
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
16957388 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
16957451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 38879657 - 38879720
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
38879657 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
38879720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 4619165 - 4619102
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4619165 |
atggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctttta |
4619102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 24448964 - 24449026
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
24448964 |
atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctttt |
24449026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 37226022 - 37225960
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || | |||||||||| || |||||||||| |
|
|
| T |
37226022 |
atggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactggattgccctttt |
37225960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 13801828 - 13801767
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
13801828 |
atggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcccttt |
13801767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 25622534 - 25622595
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||| ||||||||| |
|
|
| T |
25622534 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt |
25622595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 80
Target Start/End: Original strand, 32703496 - 32703561
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttttaga |
80 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||||| |
|
|
| T |
32703496 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttaga |
32703561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 35710385 - 35710447
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| | ||||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
35710385 |
atggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctttt |
35710447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 43334279 - 43334340
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
43334279 |
atggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgccctttt |
43334340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 16880708 - 16880647
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||| |||| |||||| |||||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
16880708 |
atggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtttcccttt |
16880647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 16028683 - 16028623
Alignment:
| Q |
17 |
ggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
16028623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 35 - 75
Target Start/End: Complemental strand, 29184102 - 29184062
Alignment:
| Q |
35 |
accatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
29184102 |
accatgcgtatgcgggagctttagtgcaccgggttgccctt |
29184062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 27328828 - 27328891
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| | |||||| |||| ||| ||||| ||||| |
|
|
| T |
27328828 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgccttttta |
27328891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 39801591 - 39801654
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttttag |
79 |
Q |
| |
|
||||||||||| ||||| ||| | |||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccattttag |
39801654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 41014392 - 41014455
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||| | ||| || |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
41014392 |
atggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctttta |
41014455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 1405261 - 1405323
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||||| | ||| |||| |||||| |||||||||| |
|
|
| T |
1405261 |
atggtgggaccctttcctgaaccctgcatatgcgggagctctagtacaccggattgccctttt |
1405323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 8170045 - 8169983
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | | || ||||||||||||||||||||| |
|
|
| T |
8170045 |
atggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccctttt |
8169983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 19143004 - 19142942
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| | | |||||||||| || ||||||||| |
|
|
| T |
19143004 |
atggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcactggcctgccctttt |
19142942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 28 - 78
Target Start/End: Original strand, 32354214 - 32354264
Alignment:
| Q |
28 |
ttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||| ||| || ||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
32354214 |
ttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttta |
32354264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 7097821 - 7097772
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcacc |
64 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
7097821 |
atggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 34154875 - 34154814
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
34154875 |
atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt |
34154814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 12006389 - 12006329
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||| ||||| ||| ||| |||||| | |||||||||||||| ||||||||| |
|
|
| T |
12006389 |
atggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 15 - 67
Target Start/End: Original strand, 43574680 - 43574732
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccggg |
67 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||| |||||||| |
|
|
| T |
43574680 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 9e-16; HSPs: 32)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 13628851 - 13628788
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
13628851 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
13628788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 40272873 - 40272811
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40272873 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
40272811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 54484787 - 54484849
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
54484787 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
54484849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 5173780 - 5173718
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||| ||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
5173780 |
atggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccctttt |
5173718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 26869802 - 26869864
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| || ||| |||||||||||||| | ||||| |||||||||||||||||||| |
|
|
| T |
26869802 |
atggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctttt |
26869864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 80
Target Start/End: Complemental strand, 29366781 - 29366716
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttttaga |
80 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||| | | |||||||||||| |||||||||||||||| |
|
|
| T |
29366781 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgcccttttaga |
29366716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 39203610 - 39203671
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
39203610 |
atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttt |
39203671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 22122978 - 22122918
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
22122978 |
atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Original strand, 22609861 - 22609921
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
22609861 |
atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 15 - 79
Target Start/End: Complemental strand, 25517231 - 25517167
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttttag |
79 |
Q |
| |
|
|||||||||||| |||||| | | ||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
25517231 |
atggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgcccttttag |
25517167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 516508 - 516570
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||| ||||||| ||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
516508 |
atggcgggaccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
516570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 13730663 - 13730601
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | |||||||||||||||||||||||||| |
|
|
| T |
13730663 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
13730601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 24851362 - 24851300
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| | | ||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
24851362 |
atggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttt |
24851300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 30452892 - 30452954
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
30452954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 40390353 - 40390399
Alignment:
| Q |
31 |
ccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40390353 |
ccgaaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
40390399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 47624207 - 47624257
Alignment:
| Q |
27 |
tttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
47624207 |
tttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
47624257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 52926280 - 52926218
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||| | |||||| ||| |||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
52926280 |
atggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttt |
52926218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 21 - 78
Target Start/End: Complemental strand, 10484671 - 10484614
Alignment:
| Q |
21 |
ggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||| |||| | ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
10484614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 14987055 - 14987116
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | |||||||||||||||||| |||||| |
|
|
| T |
14987055 |
atggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtttcccttt |
14987116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 45786275 - 45786214
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
45786275 |
atggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgcccttt |
45786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 14266431 - 14266372
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||||||||| || ||||| |||||||||| | |||||||||||| |||||||||||| |
|
|
| T |
14266431 |
tggtgggaccctt-cctgaaccctgcgtatgcgggagctttagtgcactgggttgcccttt |
14266372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 39 - 79
Target Start/End: Complemental strand, 54032608 - 54032568
Alignment:
| Q |
39 |
tgcgtatgcgagtgctttagtgcaccgggttgcccttttag |
79 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
54032608 |
tgcgtatgcgggagctttagtgcaccgggttgcccttttag |
54032568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 353410 - 353351
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccct |
74 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | ||||||||||||||||||||||| |
|
|
| T |
353410 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 66
Target Start/End: Complemental strand, 829503 - 829452
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgg |
66 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
829503 |
atggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 46421096 - 46421033
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgcttt-agtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||| |||||||||| |||||||||| |
|
|
| T |
46421096 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccctttt |
46421033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 1217184 - 1217246
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||| ||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
1217184 |
atggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1217246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 39 - 77
Target Start/End: Complemental strand, 4495713 - 4495675
Alignment:
| Q |
39 |
tgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
4495713 |
tgcgtatgcgggagctttagtgcaccgggttgccctttt |
4495675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 15797316 - 15797378
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||| | | ||| |||||||||||||||||||||| |
|
|
| T |
15797316 |
atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctttt |
15797378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 34771425 - 34771363
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||| ||||||||| |
|
|
| T |
34771425 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccctttt |
34771363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 49013534 - 49013472
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| || || ||| | |||||||||||||||||||||||||| |
|
|
| T |
49013534 |
atggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgccctttt |
49013472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 10795484 - 10795423
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||| | ||| |||||||||| | |||| |||||||| ||||||||||| |
|
|
| T |
10795484 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgcccttt |
10795423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 31592943 - 31593004
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||| | |||||| ||| ||| |||||| | ||| ||||||||||||||||||||| |
|
|
| T |
31592943 |
atggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 9e-16; HSPs: 24)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 35005222 - 35005285
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
35005222 |
atggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgccctttta |
35005285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 4349735 - 4349796
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
4349735 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4349796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 10668324 - 10668387
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| || |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
10668324 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
10668387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 27474377 - 27474440
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
27474377 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttta |
27474440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 18742018 - 18741956
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
18742018 |
atggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttccctttt |
18741956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 46248014 - 46247952
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
46248014 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctttt |
46247952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 50606500 - 50606562
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
50606500 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
50606562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 34725164 - 34725096
Alignment:
| Q |
10 |
actagatggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||| |||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
34725164 |
actaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
34725096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 18944742 - 18944805
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgcttt-agtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
18944742 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
18944805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 19414534 - 19414597
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
19414534 |
atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
19414597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 27201746 - 27201808
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
27201746 |
atggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgccctttt |
27201808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 30555212 - 30555274
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||| || ||| |||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
30555212 |
atggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgacctttt |
30555274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 42304268 - 42304206
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||| | | ||||||||||||||| |||||||||| |
|
|
| T |
42304268 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctttt |
42304206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 73
Target Start/End: Original strand, 45402193 - 45402251
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccc |
73 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
45402193 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 73
Target Start/End: Original strand, 46991901 - 46991959
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccc |
73 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
46991901 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc |
46991959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 14617135 - 14617198
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
||||||||| || |||||| ||| ||| |||||| | |||||||||||||||||| |||||||| |
|
|
| T |
14617135 |
atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctttta |
14617198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 20004151 - 20004088
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| ||||| ||| || |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
20004151 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttta |
20004088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 30395787 - 30395724
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | |||||||||||||| |||||||||||| |
|
|
| T |
30395787 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttta |
30395724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 6925197 - 6925259
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| || |||||||||| | |||||||||||||| |||||| |||| |
|
|
| T |
6925197 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgccttttt |
6925259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 35253248 - 35253186
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||| |||||||||| |
|
|
| T |
35253248 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttt |
35253186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 45812598 - 45812536
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||||| |||| ||| |||||| | ||| ||||||||||||||||| |||| |
|
|
| T |
45812598 |
atggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgccttttt |
45812536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 1517371 - 1517310
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||||| ||| | ||| ||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
1517371 |
tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttt |
1517310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 4587624 - 4587568
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgc |
71 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | |||| ||||||||||||||| |
|
|
| T |
4587624 |
atggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 9939560 - 9939624
Alignment:
| Q |
15 |
atggtgggaccct-ttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| ||| || ||| |||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
9939560 |
atggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccctttta |
9939624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 46905 - 46967
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
46905 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
46967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 24833 - 24771
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| | ||||||||||| | |||||||||||| |
|
|
| T |
24833 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgccctttt |
24771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 14)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 29355916 - 29355854
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
29355916 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
29355854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 6808469 - 6808531
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| || ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
6808469 |
atggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
6808531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 1354818 - 1354755
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
1354818 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
1354755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 12221976 - 12221913
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgcttt-agtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
12221976 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 12885987 - 12886050
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
12885987 |
atggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttta |
12886050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 1347036 - 1347098
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
1347036 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1347098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 3815138 - 3815084
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggtt |
69 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
3815138 |
atggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 12892083 - 12892145
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | |||||||||||||||||||||||||| |
|
|
| T |
12892083 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
12892145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 13267799 - 13267861
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||| | ||| |||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
13267799 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt |
13267861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 13 - 78
Target Start/End: Complemental strand, 23930190 - 23930125
Alignment:
| Q |
13 |
agatggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||||| ||| || ||| ||| |||||| | |||||||||||||| |||||||||||| |
|
|
| T |
23930190 |
agatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttta |
23930125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 3116190 - 3116128
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||| || ||| |||||||||| | |||||||| |||||| |||||||||| |
|
|
| T |
3116190 |
atggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccctttt |
3116128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 9161198 - 9161260
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||| || ||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
9161198 |
atggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctttt |
9161260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 14975151 - 14975094
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcc |
72 |
Q |
| |
|
|||||||||||| |||||||||| || |||||| | | ||||||||||||||||||| |
|
|
| T |
14975151 |
atggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 26097237 - 26097294
Alignment:
| Q |
20 |
gggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
26097237 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
26097294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000004; HSPs: 34)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 20639719 - 20639657
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
20639719 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
20639657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 38755969 - 38755908
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
38755969 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38755908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 44363191 - 44363130
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
44363191 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
44363130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 2813201 - 2813263
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgcttt-agtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| | ||||| |||||||||| ||||||||| |
|
|
| T |
2813201 |
atggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgcccttt |
2813263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 23501863 - 23501925
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
23501863 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
23501925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 32484307 - 32484369
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
32484369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 33836548 - 33836486
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
33836548 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttt |
33836486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 35567244 - 35567306
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||| | |||||||||||||||| ||||||||| |
|
|
| T |
35567244 |
atggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctttt |
35567306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 11394926 - 11394987
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| || ||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11394926 |
atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11394987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 11404653 - 11404714
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| || ||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11404653 |
atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11404714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 25388250 - 25388311
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
25388250 |
atggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt |
25388311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 40553998 - 40553937
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 5648332 - 5648394
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||| ||||||| ||||||||||||| |
|
|
| T |
5648332 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccctttt |
5648394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 20908697 - 20908635
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| | |||||||||||| || ||||||||| |
|
|
| T |
20908697 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctttt |
20908635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 25629123 - 25629185
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| | | |||||| | |||||||||||||||||||||||||| |
|
|
| T |
25629123 |
atggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgccctttt |
25629185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 30352641 - 30352579
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||| || ||| |||||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
30352641 |
atggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctttt |
30352579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 38786683 - 38786745
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
38786683 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
38786745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 48598886 - 48598824
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||||||| ||||| | ||| |||||||||||||||||||||| |
|
|
| T |
48598886 |
atggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccctttt |
48598824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 7909342 - 7909281
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgc-gagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| | | ||||||||||| |||||||||||| |
|
|
| T |
7909342 |
atggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 20225056 - 20225117
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||| |
|
|
| T |
20225056 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 20225150 - 20225211
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| |||||| ||| || |||||| | ||||||||||||||||||||||||| |
|
|
| T |
20225150 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20225211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 35532079 - 35532128
Alignment:
| Q |
28 |
ttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
35532079 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
35532128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 55766527 - 55766466
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||| |||| ||||| ||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
55766527 |
atggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgcccttt |
55766466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 6430687 - 6430627
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctt |
75 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
6430687 |
atggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 14983903 - 14983971
Alignment:
| Q |
10 |
actagatggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||| |||||||||||| |||||| ||| |||||||||| | ||||||||| ||| |||||||||||| |
|
|
| T |
14983903 |
actaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta |
14983971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 71
Target Start/End: Original strand, 21489162 - 21489218
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgc |
71 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| | ||||| |||||| ||||||| |
|
|
| T |
21489162 |
atggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 16 - 76
Target Start/End: Complemental strand, 30690236 - 30690176
Alignment:
| Q |
16 |
tggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||| | ||||||||||||| || |||||||| |
|
|
| T |
30690236 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt |
30690176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 13256457 - 13256398
Alignment:
| Q |
18 |
gtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||||| |||||||||| || | |||| | |||||||||||||||||||||||||| |
|
|
| T |
13256457 |
gtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctttt |
13256398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 16911638 - 16911701
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| |||||| ||| | |||||||| ||||||||||||||||| |
|
|
| T |
16911638 |
atggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctttta |
16911701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 74
Target Start/End: Complemental strand, 29207959 - 29207900
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccct |
74 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||| |
|
|
| T |
29207959 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 16408662 - 16408600
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
||||||| |||| |||||| ||| || |||||| | |||||||||||||||||||||||||| |
|
|
| T |
16408662 |
atggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
16408600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 30639453 - 30639515
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||| ||||| |||||| ||| ||| |||||| | |||||||||||| ||||||||||||| |
|
|
| T |
30639453 |
atggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctttt |
30639515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 14 - 76
Target Start/End: Original strand, 44718640 - 44718702
Alignment:
| Q |
14 |
gatggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
44718640 |
gatggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgcccttt |
44718702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Complemental strand, 55830782 - 55830721
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
||||||| |||| ||||| ||| |||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
55830782 |
atggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgcccttt |
55830721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 13085 - 13023
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
13085 |
atggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccctttt |
13023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 48695 - 48632
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttta |
78 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||||||||||||||| |
|
|
| T |
48695 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
48632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 10884 - 10946
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| | |||||||||||| ||||||| ||||| |
|
|
| T |
10884 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgctctttt |
10946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 30651 - 30713
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| |||||||||||||||||||||| |
|
|
| T |
30651 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 24194 - 24132
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgccctttt |
77 |
Q |
| |
|
|||||||||||| |||||| ||| ||| |||||| | ||| ||||||||||| |||||||||| |
|
|
| T |
24194 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttt |
24132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 76
Target Start/End: Original strand, 3622 - 3679
Alignment:
| Q |
19 |
tgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||| |||||||||| |||||||||| |||||||||||||| ||| |||||| |
|
|
| T |
3622 |
tgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttcccttt |
3679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 59053 - 59114
Alignment:
| Q |
15 |
atggtgggaccctttcccgaaccatgcgtatgcgagtgctttagtgcaccgggttgcccttt |
76 |
Q |
| |
|
|||||||||||| ||||| || |||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
59053 |
atggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcccttt |
59114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University